pFB-EF1a-DIO-GW1-PercevalHR-WPRE
(Plasmid
#245383)
-
PurposeCre-dependent expression of PercevalHR sensor for measuring ATP-to-ADP ratios, under the control of a EF1a promoter for mammalian cell expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 245383 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFB
-
Backbone manufacturerVirovek
- Backbone size w/o insert (bp) 4533
- Total vector size (bp) 9170
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePercevalHR
-
SpeciesSynthetic
-
Insert Size (bp)4637
- Promoter EF1a
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCAGCTTGGTTCCCAATAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that Addgene's sequencing results differ from the partial sequence information provided by the depositing laboratory, finding F54_M55insTA in the insert ORF compared to the partial reference sequence. The depositor confirms that this change is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-EF1a-DIO-GW1-PercevalHR-WPRE was a gift from D. James Surmeier (Addgene plasmid # 245383 ; http://n2t.net/addgene:245383 ; RRID:Addgene_245383) -
For your References section:
Feed-forward metabotropic signaling by Cav1 Ca(2+) channels supports pacemaking in pedunculopontine cholinergic neurons. Tubert C, Zampese E, Pancani T, Tkatch T, Surmeier DJ. Neurobiol Dis. 2023 Nov;188:106328. doi: 10.1016/j.nbd.2023.106328. Epub 2023 Oct 16. 10.1016/j.nbd.2023.106328 PubMed 37852390