pKLV2-EF1a-neoT2AFlagCDK10me3-W
(Plasmid #246512)

• Purpose: Lentiviral vector expressing human Flag-tagged gRNA-resistant mutant human CDK10 (D181N)
• Depositing Lab: Kosuke Yusa
• Depositing Organization: Kyoto University, Institute for Life and Medical Sciences
  Located in Japan
• Publication: Islam et al Cell Death Dis. 2026 Jun 11;17(1):737. doi: 10.1038/s41419-026-08973-x.

Backbone

• Vector backbone: pKLV2-EF1a-neoT2AFlagStop-W
• Backbone manufacturer: Kosuke Yusa
• Backbone size w/o insert (bp): 8948
• Total vector size (bp): 10005
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CDK10
• Species: H. sapiens (human)
• Insert Size (bp): 1080
• Mutation: Kinase-dead mutation (D181N) and silent mutations that make the cDNA resistant to 5 gRNAs are added.
• Entrez Gene: CDK10 (a.k.a. ALSAS, PISSLRE)
• Promoter: Human EF1a promoter
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACATAGCGTTGGCTACCCGT
• 3′ sequencing primer: GGGAAGCAATAGCATGATACAAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry