pKLV2-EF1a-neoT2AFlagCDK10me3-W
(Plasmid
#246512)
-
PurposeLentiviral vector expressing human Flag-tagged gRNA-resistant mutant human CDK10 (D181N)
-
Depositing Lab
-
Depositing OrganizationKyoto University, Institute for Life and Medical Sciences
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepKLV2-EF1a-neoT2AFlagStop-W
-
Backbone manufacturerKosuke Yusa
- Backbone size w/o insert (bp) 8948
- Total vector size (bp) 10005
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDK10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1080
-
MutationKinase-dead mutation (D181N) and silent mutations that make the cDNA resistant to 5 gRNAs are added.
-
Entrez GeneCDK10 (a.k.a. ALSAS, PISSLRE)
- Promoter Human EF1a promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACATAGCGTTGGCTACCCGT
- 3′ sequencing primer GGGAAGCAATAGCATGATACAAAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-EF1a-neoT2AFlagCDK10me3-W was a gift from Kosuke Yusa (Addgene plasmid # 246512 ; http://n2t.net/addgene:246512 ; RRID:Addgene_246512) -
For your References section:
CDK10 loss primes tumor cells for transcriptional vulnerability and sensitizes to CDK12/13 inhibition. Islam S, Tarumoto Y, Takano M, Sugino S, Nishibuchi G, Mizutani A, Yamakawa H, Morishita D, Yusa K. Cell Death Dis. 2026 Jun 11;17(1):737. doi: 10.1038/s41419-026-08973-x. 10.1038/s41419-026-08973-x PubMed 42270604