Skip to main content

pKLV2-U6gRNA5(FAM58A_v3_6-1)-PGKpuroBFP-W
(Plasmid #246515)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 246515 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuroGFP-W
  • Backbone manufacturer
    Kosuke Yusa
  • Backbone size w/o insert (bp) 8631
  • Total vector size (bp) 8650
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gFAM58A_v3_6-1
  • gRNA/shRNA sequence
    GTCCCGGAGTTCCCAGAAG
  • Species
    H. sapiens (human)
  • Promoter Human EF1a promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(FAM58A_v3_6-1)-PGKpuroBFP-W was a gift from Kosuke Yusa (Addgene plasmid # 246515 ; http://n2t.net/addgene:246515 ; RRID:Addgene_246515)
  • For your References section:

    CDK10 loss primes tumor cells for transcriptional vulnerability and sensitizes to CDK12/13 inhibition. Islam S, Tarumoto Y, Takano M, Sugino S, Nishibuchi G, Mizutani A, Yamakawa H, Morishita D, Yusa K. Cell Death Dis. 2026 Jun 11;17(1):737. doi: 10.1038/s41419-026-08973-x. 10.1038/s41419-026-08973-x PubMed 42270604