pX459-Dvl1/3 gRNA
(Plasmid
#246555)
-
PurposeCRISPR vector co-expressing Cas9 and a mouse Dvl1/3 gRNA (conserved region)
-
Depositing Lab
-
Depositing OrganizationJulius-Maximilians-Universitaet Wuerzburg
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 246555-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 246555-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX459
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDvl1/3 gRNA
-
gRNA/shRNA sequenceCATCACCGTCACTCTCAACA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic oligo
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CBh-SpCas9-T2A-Puro cassette on backbone
DNA (Catalog # 246555-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 246555-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-Dvl1/3 gRNA was a gift from Mario Vallon (Addgene plasmid # 246555 ; http://n2t.net/addgene:246555 ; RRID:Addgene_246555) -
For your References section:
WNT7A/B assemble a GPR124-RECK-LRP5/6 co-receptor complex to activate beta-catenin signaling in brain endothelial cells. Heiden R, Hannig L, Kuo CJ, Ergun S, Braunger BM, Vallon M. J Biol Chem. 2025 Sep 4:110682. doi: 10.1016/j.jbc.2025.110682. 10.1016/j.jbc.2025.110682 PubMed 40914247