pHR-BFP-NLS-P2A-RSV P-1xALFATag@72AA
(Plasmid
#246864)
-
PurposeExpress BFP-NLS-P2A-RSV P-1xALFATag@72AA (Pexo-ALFATag) for RSV imaging.
-
Depositing Lab
-
Depositing OrganizationHubrecht Institute
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 246864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8271
- Total vector size (bp) 9890
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBFP-NLS-P2A-RSV P-1xALFATag@72AA
-
SpeciesRSV
-
Insert Size (bp)1620
-
MutationRSV phosphoprotein (P) contains a single ALFA Tag inserted at amino acid 72.
- Promoter SFFV
-
Tag
/ Fusion Protein
- BFP-NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcccgagctctataaaagagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.03.26.645422 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-BFP-NLS-P2A-RSV P-1xALFATag@72AA was a gift from Marvin Tanenbaum (Addgene plasmid # 246864 ; http://n2t.net/addgene:246864 ; RRID:Addgene_246864) -
For your References section:
Pre-assembly of biomolecular condensate seeds drives RSV replication. Ratnayake D, Galloux M, Boersma S, Noerenberg M, Sizun C, Sacristan C, Sourimant J, Lakerveld AJ, Gelderloos AT, Apperloo L, Demyanenko Y, Baars MJD, Banerjee R, Dreier B, Furler S, Mazur NI, Bont LJ, Mohammed S, Pluckthun A, Eleouet JF, Kops GJPL, Castello A, van Kasteren PB, Rameix-Welti MA, Tanenbaum ME. Nature. 2026 Jan 28. doi: 10.1038/s41586-025-10071-5. 10.1038/s41586-025-10071-5 PubMed 41606345