TD3AD R273Q Myc
(Plasmid #246927)

• Purpose: Expresses stabilized and enzymatically deactivated trimeric ACE2 (N51C, V343C & R273Q) with a GSG linker between trimerization domain (Collagen XVIII, E31C, V37C), with Myc tag on C-terminus.
• Depositing Lab: John Williams
• Publication: Gonzales et al Commun Biol. 2025 Oct 6;8(1):1428. doi: 10.1038/s42003-025-08819-w.

Backbone

• Vector backbone: pD600
• Backbone manufacturer: ATUM (DNA2.0)
• Backbone size w/o insert (bp): 3270
• Total vector size (bp): 5309
• Modifications to backbone: none
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ACE2
• Species: H. sapiens (human)
• Insert Size (bp): 1788
• Mutation: N51C, V343C, & R273Q
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 6xHis (N terminal on insert)
  • Collagen XVIII (E31C, V37C) (N terminal on insert)
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGCACTATCGAGGAACAGGCTAAGAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositor notes that in their work they used a secretion signal to express the protein (see depositor reference sequence). They note that this signal is absent from Addgene Plasmid 246927 and confirm that it may be introduced through additional cloning, or alternatively, the protein can be obtained by lysing the cells prior to purification.