Skip to main content
Addgene
Open Menu

BEKI_pUC19_TRAC_CD19-CAR
(Plasmid #247056)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247056 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2685
  • Total vector size (bp) 5401
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD19-CAR (second generation, intermediate Fc-hinge) TRAC-HDR-template
  • Species
    H. sapiens (human), Synthetic; Bos taurus
  • Insert Size (bp)
    2716

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains an HDR-template for targeted in-frame knock-in of a CD19-CAR into the human TRAC gene (exon 1) using BEKI (Base-Editor mediated Knock-Ins).

The HDR-template is PCR-amplified using the primers: BEKI_TRAC_F TTTCAGGTTTCCTTGAGTGGCA & BEKI_TRAC_R gaggcctagaagagcagtaaggg; followed by AMPure bead-purification.

For BEKI (using nCas9-derived base editors), the KI is facilitated by a combination of two Cas9-compatible sgRNAs targeting opposite strands of the genomic DNA. Use the following protospacer sequences: 'T1': AGAGTCTCTCAGCTGGTACA & 'T9': AGAGCAACAGTGCTGTGGCC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BEKI_pUC19_TRAC_CD19-CAR was a gift from Dimitrios Wagner (Addgene plasmid # 247056 ; http://n2t.net/addgene:247056 ; RRID:Addgene_247056)

  • For your References section:

    Repurposing base editors for targeted knockin and simultaneous multiplex knockouts to generate allo-CAR T cells with minimal translocations. Glaser V, Becker LJ, Fuster-Garcia C, Aird EJ, Huth L, Nitulescu AM, Pu Y, Kassing I, Hartmann LM, Flugel CL, Karklins R, Shaji S, Pouzolles M, Stein M, Andrieux G, Corn JE, Cathomen T, Volk HD, Reinke P, Kath J, Wagner DL. Mol Ther. 2026 Jul 20:S1525-0016(26)00602-7. doi: 10.1016/j.ymthe.2026.07.034. 10.1016/j.ymthe.2026.07.034 PubMed 42478045
Related items: