Skip to main content
Addgene
Open Menu

BEKI_pTWIST_CD3z_CD19-truncCAR
(Plasmid #247057)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247057 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pTWIST
  • Backbone manufacturer
    Twist Bioscience
  • Backbone size w/o insert (bp) 2221
  • Total vector size (bp) 4452
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD19-truncCAR (second generation, intermediate Fc-hinge) CD3z-HDR-template
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2231

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains an HDR-template for targeted in-frame knock-in of a truncated CD19-CAR into the human CD3z gene (exon 2) using BEKI (Base-Editor mediated Knock-Ins). This KI-strategy creates an in-frame fusion gene with the endogenous CD3z (CD247) gene, giving rise to expression of a full-length CD19-CAR (Kath et al., 2024, Blood).

The HDR-template is PCR-amplified using the primers: 'BEKI_CD3z_F' atctgctcgccttgtttccac & 'BEKI_CD3z_R' cctctgcctgagtgtaagccc; followed by AMPure bead-purification.

For BEKI (using nCas9-derived base editors), the KI is facilitated by a combination of two Cas9-compatible sgRNAs targeting opposite strands of the genomic DNA. Use the following protospacer sequences: 'Z4': GAATGACACCATAGATGAAG & 'Z7': GAGTGAAGGTGGGTACCACT.

Note: the right homology arm contains 2 PAM-inactivating point-mutations to prevent targeting of the HDR-template by the nCas9-derived base editors.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BEKI_pTWIST_CD3z_CD19-truncCAR was a gift from Dimitrios Wagner (Addgene plasmid # 247057 ; http://n2t.net/addgene:247057 ; RRID:Addgene_247057)

  • For your References section:

    Repurposing base editors for targeted knockin and simultaneous multiplex knockouts to generate allo-CAR T cells with minimal translocations. Glaser V, Becker LJ, Fuster-Garcia C, Aird EJ, Huth L, Nitulescu AM, Pu Y, Kassing I, Hartmann LM, Flugel CL, Karklins R, Shaji S, Pouzolles M, Stein M, Andrieux G, Corn JE, Cathomen T, Volk HD, Reinke P, Kath J, Wagner DL. Mol Ther. 2026 Jul 20:S1525-0016(26)00602-7. doi: 10.1016/j.ymthe.2026.07.034. 10.1016/j.ymthe.2026.07.034 PubMed 42478045
Related items: