pGRNA2II_LacZT1
(Plasmid
#247079)
-
PurposeL-arabinose inducible crRNA of type I-E CRISPR cas (Escherichia coli K-12). encoding 105 nt spacer which targets Ecoli LacZ T1 site
-
Depositing Lab
-
Depositing OrganizationSeoul National University
Located in Republic of Korea -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET28b
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametype I-E CRISPR cas crRNA
-
gRNA/shRNA sequenceE.coli lacZ; CCGCCCTGTAAACGGGGATACTGACGAAACGCCTGCCAGTATTTAGCGAAACCGCCAAGACTGTTACCCATCGCGTGGGCGTATTCGCAAAGGATCAGCGGGCGC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds amino acids 56-95 deleted in AraC (WP_407234930.1).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGRNA2II_LacZT1 was a gift from Seokhee Kim (Addgene plasmid # 247079 ; http://n2t.net/addgene:247079 ; RRID:Addgene_247079) -
For your References section:
Continuous targeted hypermutation with a tunable mutation window. Lee C, Kim S. Nat Commun. 2025 Nov 25. doi: 10.1038/s41467-025-66736-2. 10.1038/s41467-025-66736-2 PubMed 41290661