Skip to main content

pTalin.L353F.EGFP
(Plasmid #247087)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247087 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pEGFP-C1
  • Total vector size (bp) 12357
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Talin
  • Species
    M. musculus (mouse)
  • Mutation
    L353F
  • Entrez Gene
    Tln1 (a.k.a. Tln)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer acgcaaatgggcggtagg
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTalin.L353F.EGFP was a gift from Vesa Hytönen (Addgene plasmid # 247087 ; http://n2t.net/addgene:247087 ; RRID:Addgene_247087)
  • For your References section:

    De novo talin-1 variant L353F connects multifaceted clinical symptoms to alterations in talin-1 function. Athale M, Ball N, Azizi L, Valenzuela I, Codina M, Martin-Nalda A, Mykuliak VV, Rahikainen R, Goult BT, Turkki P, Hytonen VP. Biochem J. 2025 Sep 17;482(18):1337-1352. doi: 10.1042/BCJ20253128. 10.1042/BCJ20253128 PubMed 40960860