pMinitalin.L353F.EGFP
(Plasmid
#247088)
-
PurposeExpression plasmid for the minitalin containing L353F missense mutation. The EGFP is present at the C-terminal end.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-C1
- Total vector size (bp) 6903
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMinitalin
-
Alt nameTalin ΔR1-12
-
SpeciesM. musculus (mouse)
-
Mutationdeletion of R1-12 domains, L353F
-
Entrez GeneTln1 (a.k.a. Tln)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer acgcaaatgggcggtagg
- 3′ sequencing primer GATGAGTTTGGACAAACCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMinitalin.L353F.EGFP was a gift from Vesa Hytönen (Addgene plasmid # 247088 ; http://n2t.net/addgene:247088 ; RRID:Addgene_247088) -
For your References section:
De novo talin-1 variant L353F connects multifaceted clinical symptoms to alterations in talin-1 function. Athale M, Ball N, Azizi L, Valenzuela I, Codina M, Martin-Nalda A, Mykuliak VV, Rahikainen R, Goult BT, Turkki P, Hytonen VP. Biochem J. 2025 Sep 17;482(18):1337-1352. doi: 10.1042/BCJ20253128. 10.1042/BCJ20253128 PubMed 40960860