Skip to main content

pEf1a-hifiDn29-dCas9-P2A-GFP
(Plasmid #247158)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247158 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 247158-D50 50 μg of DNA in Tris buffer $495
DNA 247158-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCB212
  • Vector type
    Mammalian Expression
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hifiDn29-dCas9-P2A-GFP
  • gRNA/shRNA sequence
    AGTGTGTATTCTGCTGTTGT
  • Species
    H. sapiens (human), Synthetic
  • Mutation
    M6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503N/I98V/I233K/I303K/K248R
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.11.01.621560 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEf1a-hifiDn29-dCas9-P2A-GFP was a gift from Patrick Hsu (Addgene plasmid # 247158 ; http://n2t.net/addgene:247158 ; RRID:Addgene_247158)
  • For your References section:

    Site-specific DNA insertion into the human genome with engineered recombinases. Fanton A, Bartie LJ, Martins JQ, Tran VQ, Goudy L, Kernick C, Durrant MG, Wei J, Armour-Garb Z, Pawluk A, Konermann S, Marson A, Gilbert LA, Roth TL, Hsu PD. Nat Biotechnol. 2025 Nov 6. doi: 10.1038/s41587-025-02895-3. 10.1038/s41587-025-02895-3 PubMed 41199024