pU6_H1-g3
(Plasmid
#247169)
-
PurposeU6 driven gRNA expression of H1-g3 for targeting Dn29 attH1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCB007
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH1-g3
-
gRNA/shRNA sequenceAGTGTGTATTCTGCTGTTGT
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Golden Gate
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.01.621560 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6_H1-g3 was a gift from Patrick Hsu (Addgene plasmid # 247169 ; http://n2t.net/addgene:247169 ; RRID:Addgene_247169) -
For your References section:
Site-specific DNA insertion into the human genome with engineered recombinases. Fanton A, Bartie LJ, Martins JQ, Tran VQ, Goudy L, Kernick C, Durrant MG, Wei J, Armour-Garb Z, Pawluk A, Konermann S, Marson A, Gilbert LA, Roth TL, Hsu PD. Nat Biotechnol. 2025 Nov 6. doi: 10.1038/s41587-025-02895-3. 10.1038/s41587-025-02895-3 PubMed 41199024