pluc HYG 5’ TMV Ω
(Plasmid
#247491)
-
PurposePlasmid pluc 5′ TMV Ω contains the 67-nt TMV Ω translational enhancer placed upstream of Firefly luciferase, optimized for boosting expression in plant transient and stable expression assays.
-
Depositing Lab
-
Depositing OrganizationAdelaide University
Located in Australia -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247491 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGreen
- Backbone size w/o insert (bp) 8814
- Total vector size (bp) 8874
-
Vector typeBacterial Expression, Plant Expression, Luciferase
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTMV Ω enhancer sequence
-
SpeciesTobacco Mosaic Virus
-
Insert Size (bp)67
- Promoter CaMV 35S
-
Tag
/ Fusion Protein
- n/a (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TATCCTTCGCAAGACCCTTC
- 3′ sequencing primer AGGAACCAGGGCGTATCTCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.10.15.682649 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pluc HYG 5’ TMV Ω was a gift from Iain Searle (Addgene plasmid # 247491 ; http://n2t.net/addgene:247491 ; RRID:Addgene_247491) -
For your References section:
The Arabidopsis CYSTM alpha 5' UTR Increases Protein Production from Transgenes in Plants and Bacteria. Khanduja JS, Wu X, Li J, Searle IR. Genes (Basel). 2026 Apr 28;17(5):520. doi: 10.3390/genes17050520. 10.3390/genes17050520 PubMed 42194977