Skip to main content

pluc HYG 5’ CYSTM1
(Plasmid #247492)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247492 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pGreen
  • Backbone size w/o insert (bp) 8814
  • Total vector size (bp) 8917
  • Vector type
    Bacterial Expression, Plant Expression, Luciferase
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CYSTM 1 (complete 5' UTR of CYSTM1 gene)
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    110
  • Promoter CaMV 35S
  • Tag / Fusion Protein
    • n/a (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TATCCTTCGCAAGACCCTTC
  • 3′ sequencing primer AGGAACCAGGGCGTATCTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.10.15.682649 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pluc HYG 5’ CYSTM1 was a gift from Iain Searle (Addgene plasmid # 247492 ; http://n2t.net/addgene:247492 ; RRID:Addgene_247492)
  • For your References section:

    The Arabidopsis CYSTM alpha 5' UTR Increases Protein Production from Transgenes in Plants and Bacteria. Khanduja JS, Wu X, Li J, Searle IR. Genes (Basel). 2026 Apr 28;17(5):520. doi: 10.3390/genes17050520. 10.3390/genes17050520 PubMed 42194977