AAV C-terminus ABE8e-V106W targeting Pex1-G844D
(Plasmid
#247655)
-
PurposeAAV genome encoding the C-terminus of ABE8e-V106W editor and Sp sgRNA cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonemodified pX601
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameC-terminus ABE8e-V106W editor and Pex1-G844D-targeting sgRNA
-
Insert Size (bp)4306
- Promoter CBh
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV C-terminus ABE8e-V106W targeting Pex1-G844D was a gift from David Liu (Addgene plasmid # 247655 ; http://n2t.net/addgene:247655 ; RRID:Addgene_247655) -
For your References section:
In vivo base editing rescues liver pathophysiology and peroxisome dysfunction in a mouse model of Zellweger spectrum disorder. Gao XD, Presa M, Duby JE, Ryan J, Piec PA, Hsu A, Banskota S, Jiang AY, Chen L, Newby GA, Di Pietro E, Levy JM, Steele BH, Lecordier S, Qin F, Moser AB, Xie J, Gao G, Braverman NE, Zuberi AR, Hacia JG, Lutz CM, Liu DR. Nat Biomed Eng. 2026 Apr 14. doi: 10.1038/s41551-026-01651-5. 10.1038/s41551-026-01651-5 PubMed 41981313