AAV N-terminus ABE8e-V106W targeting Pex1-G844D
(Plasmid
#247654)
-
PurposeAAV genome encoding the N-terminus of ABE8e-V106W editor and Sp sgRNA cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemodified pX601
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameN-terminus ABE8e-V106W editor and Pex1-G844D-targeting sgRNA
-
Insert Size (bp)4435
- Promoter CBh
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV N-terminus ABE8e-V106W targeting Pex1-G844D was a gift from David Liu (Addgene plasmid # 247654 ; http://n2t.net/addgene:247654 ; RRID:Addgene_247654) -
For your References section:
In vivo base editing rescues liver pathophysiology and peroxisome dysfunction in a mouse model of Zellweger spectrum disorder. Gao XD, Presa M, Duby JE, Ryan J, Piec P-A, Hsu A, Banskota S, Jiang AY, Chen L, Newby GA, Di Pietro E, Levy JM, Steele BH, Lecordier S, Qin F, Moser AB, Xie J, Gao G, Braverman NE, Zuberi AR, Hacia JG, Lutz CM, Liu DR. Nat. Biomed. Eng (2026). https://doi.org/10.1038/s41551-026-01651-5 10.1038/s41551-026-01651-5