PiggyBac-hyperdLbCas12a
(Plasmid
#247777)
-
PurposePiggyBac backbone with the hyperdLbCas12a expression cassette (from pSLQ11438).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePiggyBac-puro
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 12503
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameABE8e-hyperLbCas12a-mCherry-p2a-puro
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5808
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry-p2a-puro (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TTTTCCCACGAGTACTGGATGAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byStanley Qi (the hyperdLbCas12a base editing insert was removed from pSLQ11438, Addgene #183204)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.03.19.644238 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PiggyBac-hyperdLbCas12a was a gift from Aaron McKenna (Addgene plasmid # 247777 ; http://n2t.net/addgene:247777 ; RRID:Addgene_247777) -
For your References section:
BASELINE: A CRISPR Base Editing Platform for Mammalian-Scale Single-Cell Lineage Tracing. Winter E, Emiliani F, Cook A, Abderrahim A, McKenna A. bioRxiv 2025.03.19.644238 10.1101/2025.03.19.644238