pC13N-TMEM192-mGFP-3xHA-T2A-TOM20-mTagBFP-TwinStrep
(Plasmid
#247977)
-
PurposeKnock-in vector to express TMEM192-mGFP-3xHA and TOM20-mTagBFP-twinStrep from CLYBL site
-
Depositing Lab
-
Depositing OrganizationNational Human Genome Research Institute (NHGRI)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247977 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepC13N
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameTMEM192
-
SpeciesH. sapiens (human)
-
Entrez GeneTMEM192
- Promoter CAG
-
Tags
/ Fusion Proteins
- mGFP (C terminal on insert)
- 3xHA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTOM20
-
SpeciesH. sapiens (human)
-
Entrez GeneTOMM20 (a.k.a. MAS20, MOM19, TOM20)
-
Tags
/ Fusion Proteins
- mTagBFP (C terminal on insert)
- TwinStrep (C terminal on insert)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.06.23.661126 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC13N-TMEM192-mGFP-3xHA-T2A-TOM20-mTagBFP-TwinStrep was a gift from Ellen Sidransky (Addgene plasmid # 247977 ; http://n2t.net/addgene:247977 ; RRID:Addgene_247977) -
For your References section:
Bidirectional regulation of glycoprotein nonmetastatic melanoma protein B by beta-glucocerebrosidase deficiency in GBA1 isogenic dopaminergic neurons from a patient with Gaucher disease and parkinsonism. Chen C, Ma C, Sam R, Lichtenberg J, Chen T, Hao Y, Li Z, Kowal I, Andersh K, Qi YA, Perez G, Hertz E, Li Y, Williams D, Henderson MJ, Park M, Jiang X, Jerez PA, Blauwendraat C, Sidransky E, Chen Y. bioRxiv [Preprint]. 2025 Jun 25:2025.06.23.661126. doi: 10.1101/2025.06.23.661126. 10.1101/2025.06.23.661126 PubMed 40667145