pLEX307-HiBiT-GPNMB-V5
(Plasmid
#247980)
-
PurposeLentivirus vector to express HiBiT-GPNMB-V5
-
Depositing Lab
-
Depositing OrganizationNational Human Genome Research Institute (NHGRI)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247980 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLEX307
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGPNMB
-
SpeciesH. sapiens (human)
-
Entrez GeneGPNMB (a.k.a. HGFIN, NMB, PLCA3)
- Promoter EF1A
-
Tags
/ Fusion Proteins
- HiBiT (N terminal on insert)
- V5 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.06.23.661126 for bioRxiv preprint.
The depositor confirms that discrepancies between the depositor's sequence and Addgene's sequences have no functional consequences. Addgene NGS finds A224T in hGPNMB (NP_001005340.1), and the Kozak sequence deleted upstream of the insert ORF start.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX307-HiBiT-GPNMB-V5 was a gift from Ellen Sidransky (Addgene plasmid # 247980 ; http://n2t.net/addgene:247980 ; RRID:Addgene_247980) -
For your References section:
Bidirectional regulation of glycoprotein nonmetastatic melanoma protein B by beta-glucocerebrosidase deficiency in GBA1 isogenic dopaminergic neurons from a patient with Gaucher disease and parkinsonism. Chen C, Ma C, Sam R, Lichtenberg J, Chen T, Hao Y, Li Z, Kowal I, Andersh K, Qi YA, Perez G, Hertz E, Li Y, Williams D, Henderson MJ, Park M, Jiang X, Jerez PA, Blauwendraat C, Sidransky E, Chen Y. bioRxiv [Preprint]. 2025 Jun 25:2025.06.23.661126. doi: 10.1101/2025.06.23.661126. 10.1101/2025.06.23.661126 PubMed 40667145