pAAV_EF1a-FLEx(FRT)-stGtACR2:eGFP (soma-targeted)
(Plasmid
#248662)
-
PurposeExpresses a soma-targeted GtACR2 in Flp-expressing cells under the EF1a promoter for neuronal inhibition.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namestGtACR2
-
Alt namestGtACR2
-
SpeciesSynthetic
-
Insert Size (bp)1860
- Promoter EF1a
-
Tags
/ Fusion Proteins
- eGFP (C terminal on insert)
- Kv2.1 (C terminal on insert) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCAAGCCTCAGACAGTGGTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byaddgene Plasmid #105677
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-6831193/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_EF1a-FLEx(FRT)-stGtACR2:eGFP (soma-targeted) was a gift from Gordon Fishell (Addgene plasmid # 248662 ; http://n2t.net/addgene:248662 ; RRID:Addgene_248662) -
For your References section:
Feature-specific threat coding in lateral septum guides defensive action. Mazo DLB, Pasqualini AL, Wu SJ, Berger MZC, Reid CM, Brito SI, Qiu S, Levitt P, Anthony TE, Fishell G. Res Sq [Preprint]. 2025 Jun 12:rs.3.rs-6831193. doi: 10.21203/rs.3.rs-6831193/v1. 10.21203/rs.3.rs-6831193/v1 PubMed 40585201