pETM11-Sumo3-TauWT2N4R
(Plasmid #249347)

• Purpose: Expresses full-length(2N4R) human wild-type tau in E. coli. For protein purification purposes.
• Depositing Lab: Sally Cowley
• Depositing Organization: University of Oxford
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Karabova et al Alzheimers Dement. 2026 Apr;22(4):e71337. doi: 10.1002/alz.71337.
• Citations:

  1 Article

Backbone

• Vector backbone: pETM11-Sumo3-EGFP
• Backbone manufacturer: EMBL
• Backbone size w/o insert (bp): 6289
• Total vector size (bp): 6890
• Modifications to backbone: EGFP was removed from backbone and replaced with 2N4R wild-type human tau
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Use BL21 (DE3) E. coli for protein purification purposes
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tau WT (2N4R)
• Alt name: MAPT
• Species: H. sapiens (human)
• Insert Size (bp): 1326
• GenBank ID: NM_005910.6
• Entrez Gene: MAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • 6xHis-SUMO3 (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGGCCGCACTCGAGCAC
• 3′ sequencing primer: TCCACCGGTCTGTTGCTGGAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Backbone was provided by EMBL, and the insert was provided by the ODDI.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2025.07.17.664991 for the bioRxiv preprint.

Please also see Karabova et al. (2026) Protocol for efficient purification of endotoxin-free human recombinant tau protein. STAR Protoc. doi: https://doi.org/10.1016/j.xpro.2026.104800.