PiggyBAC U6 shNedd4l
(Plasmid
#249589)
-
PurposeKnockdown Nedd4l and integrate sequence into the genome
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepiggybac
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNedd4l
-
gRNA/shRNA sequenceTTTATTAAGGGCTTTGCCTGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneNedd4l (a.k.a. 1300012C07Rik, NEDD4.2, Nedd4-2, Nedd4b)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PiggyBAC U6 shNedd4l was a gift from Cagla Eroglu (Addgene plasmid # 249589 ; http://n2t.net/addgene:249589 ; RRID:Addgene_249589) -
For your References section:
Neuroligin-2 is ubiquitinated by Nedd4l to control developmental astrocyte morphogenesis. Sakers K, Ramirez JJ, Elazar N, Nagendren L, Soderblom E, Eroglu C. J Cell Biol. 2026 Jul 6;225(7):e202512111. doi: 10.1083/jcb.202512111. Epub 2026 Jun 1. 10.1083/jcb.202512111 PubMed 42223381