Skip to main content

PiggyBAC U6 shNedd4l
(Plasmid #249589)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249589 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    piggybac
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nedd4l
  • gRNA/shRNA sequence
    TTTATTAAGGGCTTTGCCTGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nedd4l (a.k.a. 1300012C07Rik, NEDD4.2, Nedd4-2, Nedd4b)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PiggyBAC U6 shNedd4l was a gift from Cagla Eroglu (Addgene plasmid # 249589 ; http://n2t.net/addgene:249589 ; RRID:Addgene_249589)
  • For your References section:

    Neuroligin-2 is ubiquitinated by Nedd4l to control developmental astrocyte morphogenesis. Sakers K, Ramirez JJ, Elazar N, Nagendren L, Soderblom E, Eroglu C. J Cell Biol. 2026 Jul 6;225(7):e202512111. doi: 10.1083/jcb.202512111. Epub 2026 Jun 1. 10.1083/jcb.202512111 PubMed 42223381