pAC51b
(Plasmid
#249663)
-
PurposeDual plasmid system for arabinose sensing in Snodgrassella alvi
-
Depositing Lab
-
Depositing OrganizationUniversite de Lausanne (UNIL)
Located in Switzerland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249663 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAC17v5b
-
Vector typeBacterial Expression ; Arabinose biosensor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namearaC
-
Insert Size (bp)879
-
Entrez GenearaC (a.k.a. b0064, ECK0065)
- Promoter CP25
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer atctgaatcatgcgcggatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC51b was a gift from Yolanda Schaerli (Addgene plasmid # 249663 ; http://n2t.net/addgene:249663 ; RRID:Addgene_249663)