WEbbm
(Plasmid
#249677)
-
PurposeBeYDV replicon with WIND1, ESR1-GmBBM cascade, sgRNA targeting N. benthamiana PDS. RUBY as reporter.
-
Depositing Lab
-
Depositing OrganizationTexas Tech University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249677 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTRANS_231
-
Backbone manufacturerCambia
- Backbone size w/o insert (bp) 11947
- Total vector size (bp) 21031
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EPI300
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWIND1, ESR1, GmBBM, RUBY, sgRNA
-
gRNA/shRNA sequenceTTGGTAGTAGCGACTCCATG
-
SpeciesArabidopsis, Glycine max, Nicotiana benthamiana
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer Unknown (Unknown if destroyed)
- 3′ sequencing primer Unknown (Unknown if destroyed)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WEbbm was a gift from Gunvant Patil (Addgene plasmid # 249677 ; http://n2t.net/addgene:249677 ; RRID:Addgene_249677) -
For your References section:
A synthetic transcription cascade enables direct in planta shoot regeneration for transgenesis and gene editing in multiple plants. Kshetry AO, Ghose K, Alok A, Devkar V, Raman V, Stupar RM, Herrera-Estrella L, Zhang F, Patil GB. Mol Plant. 2025 Nov 6:S1674-2052(25)00322-3. doi: 10.1016/j.molp.2025.09.017. 10.1016/j.molp.2025.09.017 PubMed 41202820