Skip to main content
Addgene
Open Menu

pAAV-EF1a-DIO-pAce-Kv-WPRE
(Plasmid #250152)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250152 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pAAV-EF1a
  • Backbone size w/o insert (bp) 5599
  • Total vector size (bp) 7231
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pAce-Kv
  • Alt name
    pAce-Kv2.1
  • Species
    G. gallus (chicken), Synthetic
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (unknown if destroyed)
  • 3′ cloning site Nhe1 (unknown if destroyed)
  • 5′ sequencing primer tcaagcctcagacagtggttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-DIO-pAce-Kv-WPRE was a gift from Michael Lin (Addgene plasmid # 250152 ; http://n2t.net/addgene:250152 ; RRID:Addgene_250152)

  • For your References section:

    Kilohertz volumetric imaging of in vivo dynamics using squeezed light field microscopy. Wang Z, Zhao R, Wagenaar DA, Espino D, Sheintuch L, Benshlomo O, Kang W, Zhu E, Lee CK, Schmidt WC, Pammar A, Wang J, Wong GCL, Liang R, Lee S, Lin MZ, Kannan M, Golshani P, Hsiai TK, Gao L. Nat Methods. 2025 Oct;22(10):2194-2204. doi: 10.1038/s41592-025-02843-8. Epub 2025 Sep 23. 10.1038/s41592-025-02843-8 PubMed 40987870
Related items: