Full Length Rat Bassoon
(Plasmid
#250160)
-
PurposeExpresses Rat Bassoon in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversitaetsmedizin Goettingen
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4113
- Total vector size (bp) 15927
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EPI300
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBassoon
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)11814
-
Entrez GeneBsn (a.k.a. Znf231)
- Promoter CMV IE94
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer TAGGCGTGCCTAATGGGAGGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
1) Identification of Bassoon: https://doi.org/10.1083/jcb.142.2.499
2) First description of a full-length recombinant Bassoon construct: https://doi.org/10.1016/S1044-7431(03)00015-0
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Full Length Rat Bassoon was a gift from Thomas Dresbach (Addgene plasmid # 250160 ; http://n2t.net/addgene:250160 ; RRID:Addgene_250160) -
For your References section:
Establishing synthetic ribbon-type active zones in a heterologous expression system. Kapoor R, Do TT, Schwenzer N, Petrovic A, Dresbach T, Lehnart SE, Fernandez-Busnadiego R, Moser T. Elife. 2026 Jan 13;13:RP98254. doi: 10.7554/eLife.98254. 10.7554/eLife.98254 PubMed 41528127