pLX304-Lantern-MAVS
(Plasmid
#250917)
-
PurposeExpresses Lantern fused to the C-terminal 31 amino acids of MAVS in mammalian cells for targeting to the outer mitochondrial membrane
-
Depositing Lab
-
Depositing OrganizationPeking University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLX304
- Backbone size w/o insert (bp) 7650
- Total vector size (bp) 8118
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLantern
-
SpeciesH. sapiens (human)
-
Insert Size (bp)468
- Promoter CMV
-
Tags
/ Fusion Proteins
- V5 (N terminal on insert)
- MAVS C-terminal fragment (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGAGGAGAAAATGAAAGCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-6890342/v1 for ResearchSquare preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX304-Lantern-MAVS was a gift from Peng Zou (Addgene plasmid # 250917 ; http://n2t.net/addgene:250917 ; RRID:Addgene_250917) -
For your References section:
Directed evolution of Lantern enables rapid RNA and protein proximity labeling. Fang Y, Ren Z, Zheng F, Wang R, Zhao S, Zhang Y, Wang W, Li C, Liu-Yang L, Lin C, Liu J, Zou P. Nat Chem Biol. 2026 Sep 7. doi: 10.1038/s41589-026-02313-y. 10.1038/s41589-026-02313-y PubMed 42706326