Skip to main content

PRINCE-SpCas9-2
(Plasmid #250956)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250956 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBR322
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    H1-TetO-SpCas9 sgRNA scaffold; EF1α-optTetR
  • Species
    Synthetic
  • Promoter H1 promoter; EF1α promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer cgaacgctgacgtcatcaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PRINCE-SpCas9-2 was a gift from Yu Wang (Addgene plasmid # 250956 ; http://n2t.net/addgene:250956 ; RRID:Addgene_250956)
  • For your References section:

    Coordinated regulation using small-molecule drugs enables controlled therapeutic genome editing and enhanced genomic precision in situ. Zhang J, Chen L, Zhu X, Cai Y, Wei S, Zhou X, Shi Y, Liu C, Huang C, Bi S, Wu F, Zhou X, Hong J, Wang Y. Sci Transl Med. 2026 May 27;18(851):eadx7857. doi: 10.1126/scitranslmed.adx7857. Epub 2026 May 27. 10.1126/scitranslmed.adx7857 PubMed 42202045