PRINCE-SaCas9-1
(Plasmid
#250957)
-
PurposePRINCE drug inducible gene editing system based on SaCas9 (AAV-Part I : the expression of SaCas9-NES)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1α-SaCas9; NES; NpuN;
-
SpeciesSynthetic
- Promoter EF1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer gggcagagcgcacatcgccc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PRINCE-SaCas9-1 was a gift from Yu Wang (Addgene plasmid # 250957 ; http://n2t.net/addgene:250957 ; RRID:Addgene_250957) -
For your References section:
Coordinated regulation using small-molecule drugs enables controlled therapeutic genome editing and enhanced genomic precision in situ. Zhang J, Chen L, Zhu X, Cai Y, Wei S, Zhou X, Shi Y, Liu C, Huang C, Bi S, Wu F, Zhou X, Hong J, Wang Y. Sci Transl Med. 2026 May 27;18(851):eadx7857. doi: 10.1126/scitranslmed.adx7857. Epub 2026 May 27. 10.1126/scitranslmed.adx7857 PubMed 42202045