pLEX307-EGFP-lysenin
(Plasmid
#251000)
-
PurposeLentiviral vector with constitutive expression of EGFP-lysenin for visualization of sphingomyelin
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLEX307
-
Backbone manufacturerDavid Root (Addgene plasmid #41392)
- Backbone size w/o insert (bp) 8415
- Total vector size (bp) 10032
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelysenin
-
SpeciesEisenia fetida
-
Insert Size (bp)888
-
MutationN-terminal methionine not included, W20A mutation
-
GenBank IDD85846
- Promoter EF-1a
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFelix Randow, MRC Laboratory of Molecular Biology, Cambridge, UK
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX307-EGFP-lysenin was a gift from Jörn Coers (Addgene plasmid # 251000 ; http://n2t.net/addgene:251000 ; RRID:Addgene_251000) -
For your References section:
RNF213-dependent lytic destruction of Chlamydia-containing vacuoles activates host cell death pathways. Dickinson MS, Walsh SC, Bastidas RJ, Valdivia RH, Coers J. Proc Natl Acad Sci U S A. 2026 Sep;123(35):e2606688123. doi: 10.1073/pnas.2606688123. Epub 2026 Aug 27. 10.1073/pnas.2606688123 PubMed 42658761