pLEX307-EGFP-lysenin
(Plasmid #251000)

• Purpose: Lentiviral vector with constitutive expression of EGFP-lysenin for visualization of sphingomyelin
• Depositing Lab: Jörn Coers
• Publication: RNF213-dependent lytic destruction of Chlamydia-containing vacuoles activates host cell death pathways (unpublished)

Backbone

• Vector backbone: pLEX307
• Backbone manufacturer: David Root (Addgene plasmid #41392)
• Backbone size w/o insert (bp): 8415
• Total vector size (bp): 10032
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: lysenin
• Species: Eisenia fetida
• Insert Size (bp): 888
• Mutation: N-terminal methionine not included, W20A mutation
• GenBank ID: D85846
• Promoter: EF-1a
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Felix Randow, MRC Laboratory of Molecular Biology, Cambridge, UK

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry