Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80925)


Item Catalog # Description Quantity Price (USD)
Plasmid 80925 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 14386
  • Modifications to backbone
    Ires-eGFP inserted
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    mouse Piezo1 CDS
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Piezo1 (a.k.a. 9630020g22, Fam38a, mKIAA0233)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mPiezo1-IRES-eGFP was a gift from Ardem Patapoutian (Addgene plasmid # 80925 ; ; RRID:Addgene_80925)
  • For your References section:

    Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels. Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin AE, Patapoutian A. Science. 2010 Oct 1;330(6000):55-60. doi: 10.1126/science.1193270. Epub 2010 Sep 2. 10.1126/science.1193270 PubMed 20813920