Skip to main content

pLV-KLF17-CRa1-MS2
(Plasmid #251117)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251117 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    lenti sgRNA(MS2)_puro optimized backbone
  • Backbone manufacturer
    Feng Zhang (Addgene #73797)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA1 targeting KLF17 promoter
  • gRNA/shRNA sequence
    CCCTCACCATGCCCCAACCA
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    KLF17 (a.k.a. ZLF393, ZNF393, Zfp393)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-KLF17-CRa1-MS2 was a gift from Ting Zhou (Addgene plasmid # 251117 ; http://n2t.net/addgene:251117 ; RRID:Addgene_251117)
  • For your References section:

    Leveraging CRISPR activation for rapid assessment of gene editing products in human pluripotent stem cells. Wu Y, Zhong A, Evangelisti A, Sidharta M, Danwei H, Studer L, Zhou T. Stem Cell Reports. 2025 Apr 25:102499. doi: 10.1016/j.stemcr.2025.102499. 10.1016/j.stemcr.2025.102499 PubMed 40345204