lentiGuide-Puro-P2A-EGFP-PJY392
(Plasmid
#251161)
-
PurposeCloning backbone for guide RNAs compatible with 10x FLEX
-
Depositing Lab
-
Depositing OrganizationJ. David Gladstone Institutes
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiGuide-puro
-
Backbone manufacturerFeng Zhang, Addgene plasmid #52963
- Total vector size (bp) 10973
-
Modifications to backboneReplaced SpCas9 sgRNA scaffold to F+E version for compatibility with 10x FLEX. Replaced PuroR by PuroR-P2A-EGFP
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9 sgRNA F+E
-
gRNA/shRNA sequenceNA
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer hU6-F (GACTATCATATGCTTACCGT)
- 3′ sequencing primer ATTGTGGATGAATACTGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2025.12.23.696273 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiGuide-Puro-P2A-EGFP-PJY392 was a gift from Alexander Marson (Addgene plasmid # 251161 ; http://n2t.net/addgene:251161 ; RRID:Addgene_251161) -
For your References section:
Genome-scale perturb-seq in primary human CD4(+) T cells maps context-specific regulators of T cell programs and human immune traits. Zhu R, Dann E, Yan J, Reyes Retana J, Goto R, Guitche RC, Brixi L, Ota M, Hartman A, Roth TL, Satpathy AT, Pritchard JK, Marson A. Cell. 2026 Aug 28:S0092-8674(26)00929-3. doi: 10.1016/j.cell.2026.08.002. 10.1016/j.cell.2026.08.002 PubMed 42664972