Skip to main content

pX458- PSMF1 guide 1
(Plasmid #251203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251203 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pX458
  • Backbone manufacturer
    Feng Zhang Lab, addgene #48138
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PSMF1 guide 1
  • gRNA/shRNA sequence
    CCTTGTGAAAGCCATCACCG
  • Species
    Synthetic

Cloning Information

  • Cloning method Golden Gate

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458- PSMF1 guide 1 was a gift from Wade Harper (Addgene plasmid # 251203 ; http://n2t.net/addgene:251203 ; RRID:Addgene_251203)
  • For your References section:

    Regulation of the proteasome 20S core particle by the Parkinsonism-associated Proteins FBXO7 and PI31. Adolf F, Goodall EA, Singh E, von Gronau S, Fermin Perez E, Fung D, Müller B, Paulo JA, Hanna J, Harper JW, Schulman BA. bioRxiv 2026.05.28.728263 10.64898/2026.05.28.728263