pX458- PSMF1 guide 2
(Plasmid
#251204)
-
PurposeTransient transfection-compatible vector driving expression of spCas9 and production of sgRNA targeting exon2 of PSMF1
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang Lab, addgene #48138
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePSMF1 guide 2
-
gRNA/shRNA sequenceCCGGTATGAGTATAAGGATG
-
SpeciesSynthetic
Cloning Information
- Cloning method Golden Gate
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458- PSMF1 guide 2 was a gift from Wade Harper (Addgene plasmid # 251204 ; http://n2t.net/addgene:251204 ; RRID:Addgene_251204) -
For your References section:
Regulation of the proteasome 20S core particle by the Parkinsonism-associated Proteins FBXO7 and PI31. Adolf F, Goodall EA, Singh E, von Gronau S, Fermin Perez E, Fung D, Müller B, Paulo JA, Hanna J, Harper JW, Schulman BA. bioRxiv 2026.05.28.728263 10.64898/2026.05.28.728263