pLV_CMV_Prss-AtagIB-Halo-KDEL
(Plasmid
#251342)
-
PurposeER targeted anti-Alfatag intrabody tagged with Halotag, Lentiviral backbone, CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 7922
- Total vector size (bp) 9326
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namealfatagscfv
-
Insert Size (bp)366
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_CMV_Prss-AtagIB-Halo-KDEL was a gift from Edward Avezov (Addgene plasmid # 251342 ; http://n2t.net/addgene:251342 ; RRID:Addgene_251342) -
For your References section:
FidlTrack: high-fidelity structure-aware single particle tracking resolves intracellular molecular motion in organelles sensing APP processing. Parutto P, Yuan Y, Davi V, Pons-Lanau R, Ebeling S, Gupta K, Bottanelli F, Garcia-Parajo MF, Campelo F, Kaminski CF, Chambers JE, Nixon-Abell J, Avezov E. Nat Commun. 2026 Feb 11;17(1):2639. doi: 10.1038/s41467-026-69067-y. 10.1038/s41467-026-69067-y PubMed 41672994