csr-1_qa-2_dsimpα_bar
(Plasmid
#251402)
-
PurposeEnables inducible expression of double-stranded RNA targeting importin α (NCU01249) under the control of the qa-2 promoter, with the expression cassette inserted at the csr-1 locus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRS426
- Total vector size (bp) 11074
-
Vector typeRNAi
-
Selectable markersphosphinothricin and Cyclosporin A
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameimportin alpha
-
Alt nameNCU01249
-
gRNA/shRNA sequenceTGTTCAGACCCAGGTTATCATTAACTGCGGTGCCCTTCCCTGCCTCCTGTCGCTTCTGAGCTCCAACAAGGATGGCATCCGCAAGGAGGCTTGCTGGACCATCAGCAACATTACTGCTGGAAACTCGGCTCAGATCCAATCTGTCATTGACGCCAACATCATCCCTCCTTTGATCCACCTTCTCTCCCATGCCGACCTCAAGACTCGTAAGGAGGCCTGCTGGGCTATCAGCAACGCGACTTCGGGTGGTCTCCAGAAGCCCGATCAGATCAGATACTTGGTTGCTCAAGGCTGCATCAAGCCGCTCTGCGACCTTCTGGCTTGCCCTGACAACAAGATTATCCAGGTTGCCCTGGATGGTCTTGAGAATATTCTCAAGGTTGGCGAGCTCGACAAGAACGCCGCTGGCGATGGCCCTGACTCGATCAACCGTTATGCCCTATTTATCGAGGAATGCGGAGGAATGGAGAAGATTCACGACTGCCAGACGAACGCCAACG
-
SpeciesNeurospora crassa
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
csr-1_qa-2_dsimpα_bar was a gift from Jay C Dunlap (Addgene plasmid # 251402 ; http://n2t.net/addgene:251402 ; RRID:Addgene_251402) -
For your References section:
Rhythmic Nuclear Import Mediated by Importins Regulates the Neurospora Circadian Clock. Wang Z, Wang B, Bartholomai BM, Loros JJ, Dunlap JC. Genetics. 2026 May 18:iyag126. doi: 10.1093/genetics/iyag126. 10.1093/genetics/iyag126 PubMed 42144878