Skip to main content

pENTR221-miniCMVp-Blast-P2A-IKZF3d
(Plasmid #251482)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251482 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pENTR221
  • Backbone size w/o insert (bp) 2790
  • Total vector size (bp) 3301
  • Modifications to backbone
    With the removal of attB2, this vector cannot be used for Gateway (lambda att-type) recombinational cloning purposes.
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IKZF3d
  • Species
    Synthetic
  • Promoter minimal CMV Promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTGGTTATGTGTGGGAGGG
  • 3′ sequencing primer CAGGAAACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Alessandra Ianari, William Sellers, Addgene Plasmid #185774

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR221-miniCMVp-Blast-P2A-IKZF3d was a gift from Tomoharu Kanie (Addgene plasmid # 251482 ; http://n2t.net/addgene:251482 ; RRID:Addgene_251482)
  • For your References section:

    A bulk cell heterozygous knock-in strategy for targeted protein degradation. Liu B, Qi C, Kanie T. bioRxiv 2026.05.19.726384 10.64898/2026.05.19.726384