pENTR221-miniCMVp-Blast-P2A-IKZF3d
(Plasmid
#251482)
-
PurposeThis vector serves as a PCR template to generate donor DNA that is used for knocking-in IKZF3d for conditional protein degradation. MiniCMV promoter may enhance the expression of IKZF3d-tagged protein
-
Depositing Lab
-
Depositing OrganizationUniversity of Oklahoma Health Sciences Center
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251482 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepENTR221
- Backbone size w/o insert (bp) 2790
- Total vector size (bp) 3301
-
Modifications to backboneWith the removal of attB2, this vector cannot be used for Gateway (lambda att-type) recombinational cloning purposes.
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIKZF3d
-
SpeciesSynthetic
- Promoter minimal CMV Promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTGGTTATGTGTGGGAGGG
- 3′ sequencing primer CAGGAAACAGCTATGACCATG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAlessandra Ianari, William Sellers, Addgene Plasmid #185774
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR221-miniCMVp-Blast-P2A-IKZF3d was a gift from Tomoharu Kanie (Addgene plasmid # 251482 ; http://n2t.net/addgene:251482 ; RRID:Addgene_251482) -
For your References section:
A bulk cell heterozygous knock-in strategy for targeted protein degradation. Liu B, Qi C, Kanie T. bioRxiv 2026.05.19.726384 10.64898/2026.05.19.726384