pENTR221-sEFp-Blast-P2A-HaloTag
(Plasmid
#251486)
-
PurposeThis vector serves as a PCR template to generate donor DNA that is used for knocking-in HaloTag for conditional protein degradation. Short EF promoter enhances the expression of Halo-tagged protein.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepENTR221
- Backbone size w/o insert (bp) 2790
- Total vector size (bp) 4254
-
Modifications to backboneWith the removal of attB2, this vector cannot be used for Gateway (lambda att-type) recombinational cloning purposes.
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag7
-
SpeciesSynthetic
- Promoter short EF Promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTGGTTATGTGTGGGAGGG
- 3′ sequencing primer CAGGAAACAGCTATGACCATG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAlessandra Ianari, William Sellers, Addgene Plasmid #185772
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR221-sEFp-Blast-P2A-HaloTag was a gift from Tomoharu Kanie (Addgene plasmid # 251486 ; http://n2t.net/addgene:251486 ; RRID:Addgene_251486) -
For your References section:
A bulk cell heterozygous knock-in strategy for targeted protein degradation. Liu B, Qi C, Kanie T. bioRxiv 2026.05.19.726384 10.64898/2026.05.19.726384