Skip to main content
Addgene
Open Menu

MiniCoopR CRISPRi 2xU6:gRNA, mitfa:dCas9-KRAB-MeCP2
(Plasmid #251742)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 251742 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    MiniCoopR
  • Modifications to backbone
    CRISPRi 2xU6-gRNA, mitfa-dCas9-KRAB-MeCP2
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use the BseRI enzyme to clone gRNA of interest in the first U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert. Use the aaRI enzyme to clone gRNA of interest in the second U6:gRNA cassette.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MiniCoopR CRISPRi 2xU6:gRNA, mitfa:dCas9-KRAB-MeCP2 was a gift from Megan Insco (Addgene plasmid # 251742 ; http://n2t.net/addgene:251742 ; RRID:Addgene_251742)

  • For your References section:

    Recurrent ZC3H18 mutations stabilize oncogenic endogenous retroviral RNA. Tanu T, Cox AM, Karlow JA, Sharma P, Sun K, He X, Babu S, Roelofs MK, Jeon E, Chen J, Wu C, Brown J, Barrientos NB, McCallion AS, Brown KM, Chanock SJ, Liu D, Zhang T, Burns KH, Boutz PL, Insco ML. Cell Rep. 2026 Jun 24;45(7):117526. doi: 10.1016/j.celrep.2026.117526. 10.1016/j.celrep.2026.117526 PubMed 42340846
Related items: