pOPINVHH_BA.1_C2
(Plasmid
#251751)
-
PurposeProtein expression in E. coli
-
Depositing Lab
-
Depositing OrganizationRosalind Franklin Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepADL-23c
-
Backbone manufacturerAntibody Design Labs
- Backbone size w/o insert (bp) 3960
- Total vector size (bp) 4348
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNanobody BA.1_C2
-
Speciesllama
- Promoter T7
-
Tag
/ Fusion Protein
- Hexahistidine (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTCCGGCTCGTATGTTG
- 3′ sequencing primer GTCGTCTTTCCAGACGTTAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINVHH_BA.1_C2 was a gift from Ray Owens (Addgene plasmid # 251751 ; http://n2t.net/addgene:251751 ; RRID:Addgene_251751)