pT3-EF1a-MYC-IRES-CRE
(Plasmid
#252085)
-
PurposeStably expresses human MYC, IRES, and CRE from the EF1a promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepT3-EF1a
- Backbone size w/o insert (bp) 3107
- Total vector size (bp) 8495
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMYC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3700
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
- Promoter Ef1a
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was synthesized by Synthego.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://https://doi.org/10.1101/2025.07.29.667471 for bioRxiv preprint.
The Addgene sequence result contains f1 ori, while the depositor provided reference does not. Additionally, the region with AmpR and ori is inverted in the Addgene sequence result when compared to depositor-provided reference sequence.The depositor confirms these discrepancies do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT3-EF1a-MYC-IRES-CRE was a gift from Andrei Goga (Addgene plasmid # 252085 ; http://n2t.net/addgene:252085 ; RRID:Addgene_252085) -
For your References section:
Alanine catabolism as a targetable vulnerability for MYC-driven liver cancer. Montoya T, Lee JV, Qiu L, Krall A, Matulionis N, Seo Y, Finck BN, Kelley RK, Christofk H, Goga A. bioRxiv [Preprint]. 2025 Aug 12:2025.07.29.667471. doi: 10.1101/2025.07.29.667471. 10.1101/2025.07.29.667471 PubMed 40766546