Skip to main content
Addgene
Open Menu

pTET-tight-CES1WT
(Plasmid #252212)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 252212 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pTET-tight-MCS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Carboxylesterase 1 (CES1), transcript variant 2, mRNA (NCBI: NM_001025194.2)
  • Species
    H. sapiens (human)
  • Entrez Gene
    CES1 (a.k.a. ACAT, CE-1, CEH, CES2, HMSE, HMSE1, PCE-1, REH, SES1, TGH, hCE-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GAGGTAGGCGTGTACGGTGGGAGG
  • 3′ sequencing primer CCCTGAAAACTTTGCCCCCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTET-tight-CES1WT was a gift from Stephen Duncan (Addgene plasmid # 252212 ; http://n2t.net/addgene:252212 ; RRID:Addgene_252212)

  • For your References section:

    Triazine Thiols Decrease Apolipoprotein B Secretion From Hepatocytes Through Inhibition of Human Carboxylesterase 1. Blaszkiewicz J, Jiang YL, Liu JT, Martinez-Morant C, Dearth T, van Altena C, Lamprecht MP, Kappler C, Lee MH, Bethard JR, Ball LE, Duncan SA. Cell Mol Gastroenterol Hepatol. 2026;20(8):101796. doi: 10.1016/j.jcmgh.2026.101796. Epub 2026 Apr 29. 10.1016/j.jcmgh.2026.101796 PubMed 42061645
Related items: