3a-MinEpd
(Plasmid
#252608)
-
PurposeMoClo part plasmid expressing P. damselae protein as part 3a
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepYTK001(Addgene #65108)
-
Backbone manufacturerJohn Dueber
- Backbone size w/o insert (bp) 1600
- Total vector size (bp) 1965
-
Vector typeBacterial Expression, Synthetic Biology ; Part plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMinE from Photobacterium damselae
-
SpeciesPhotobacterium damselae
-
Insert Size (bp)307
-
MutationStop codon deleted to enable C-terminal fusion via MoClo workflow
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGCGGAGCCTATGGAAAAACGC
- 3′ sequencing primer gaattacaacagtactgcgatgagtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3a-MinEpd was a gift from Scott Coyle (Addgene plasmid # 252608 ; http://n2t.net/addgene:252608 ; RRID:Addgene_252608) -
For your References section:
Noise-Guided Design of Synthetic Protein Waves in Living Cells. Bolshakov DT, Weix EWZ, Galateo TM, Rajasekaran R, Coyle SM. ACS Synth Biol. 2025 Dec 16. doi: 10.1021/acssynbio.5c00599. 10.1021/acssynbio.5c00599 PubMed 41400440