Skip to main content

mNg-MinDec Tef TU
(Plasmid #252609)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 252609 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pYTK095 (Addgene #65202)
  • Backbone manufacturer
    John Dueber
  • Vector type
    Bacterial Expression, Synthetic Biology ; Transcriptional unit

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mNeongreen-MinDec fusion
  • Species
    Escherichia coli
  • Insert Size (bp)
    810
  • Mutation
    Stop codon deleted to enable C-terminal fusion via MoClo workflow

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer GGCGGAGCCTATGGAAAAACGC
  • 3′ sequencing primer aaaacttcatttttaatttaaaaggatctag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mNg-MinDec Tef TU was a gift from Scott Coyle (Addgene plasmid # 252609 ; http://n2t.net/addgene:252609 ; RRID:Addgene_252609)
  • For your References section:

    Noise-Guided Design of Synthetic Protein Waves in Living Cells. Bolshakov DT, Weix EWZ, Galateo TM, Rajasekaran R, Coyle SM. ACS Synth Biol. 2025 Dec 16. doi: 10.1021/acssynbio.5c00599. 10.1021/acssynbio.5c00599 PubMed 41400440