MinEec-mRuby2 Tef TU
(Plasmid
#252610)
-
PurposeEncodes transcriptional unit with following construction: L1-pTef1-MinEec-mRuby-tADH-RE
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneYTK095 (Addgene #65202)
-
Backbone manufacturerJohn Dueber
-
Vector typeBacterial Expression, Synthetic Biology ; Transcriptional unit
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMinEec-mRuby2 fusion
-
SpeciesEscherichia coli
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGCGGAGCCTATGGAAAAACGC
- 3′ sequencing primer aaaacttcatttttaatttaaaaggatctag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MinEec-mRuby2 Tef TU was a gift from Scott Coyle (Addgene plasmid # 252610 ; http://n2t.net/addgene:252610 ; RRID:Addgene_252610) -
For your References section:
Noise-Guided Design of Synthetic Protein Waves in Living Cells. Bolshakov DT, Weix EWZ, Galateo TM, Rajasekaran R, Coyle SM. ACS Synth Biol. 2025 Dec 16. doi: 10.1021/acssynbio.5c00599. 10.1021/acssynbio.5c00599 PubMed 41400440