pRRL.PPT-SFFV-MCS-IRES2-AG
(Plasmid
#252768)
-
PurposeLentiviral overexpression of a gene of interest cloned into MCS; co-expresses Azami Green
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRRL.PPT-SFFV-MCS-IRES2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAzami Green
-
SpeciesGalaxea fascicularis
-
Insert Size (bp)675
- Promoter SFFV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgtggttttcctttgaaaaacacgatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL.PPT-SFFV-MCS-IRES2-AG was a gift from Filipe Pereira (Addgene plasmid # 252768 ; http://n2t.net/addgene:252768 ; RRID:Addgene_252768)
