Skip to main content

pRBC-PINBodyC-Tau(297-441)-404 TAG-his6
(Plasmid #253345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253345 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRBC
  • Backbone manufacturer
    custom
  • Total vector size (bp) 6845
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Tau 2N4R S404TAG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    456
  • Mutation
    Serine 404 to TAG codon, deleted amino acids 1-296
  • Entrez Gene
    MAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
  • Promoter T7
  • Tags / Fusion Proteins
    • His6 (C terminal on insert)
    • PINBodyC (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRBC-PINBodyC-Tau(297-441)-404 TAG-his6 was a gift from Richard Cooley (Addgene plasmid # 253345 ; http://n2t.net/addgene:253345 ; RRID:Addgene_253345)
  • For your References section:

    Accessing intractable, phosphorylated intrinsically disordered proteins via a protease-cleavable inclusion body tag. Vesely CH, Stanisheuski S, Lien E, Reardon P, Chung PJ, Mehl RA, Cooley RB. Protein Sci. 2026 Apr;35(4):e70520. doi: 10.1002/pro.70520. 10.1002/pro.70520 PubMed 41820804