pDonorRMCE-For-dl3-mTagBFP2
(Plasmid
#253436)
-
PurposeDonor plasmid for FLP/FRT mediated recombination into landing pad in the forward direction with mutant Ef1a promoter - dl3
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDonorRMCE-For-FRT-MCS-mTagBFP2wintron-SV40pA-FRT3
-
Vector typeMammalian Expression, Mouse Targeting ; FLP/FRT
-
Selectable markersmTagBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedl3 Promoter
-
SpeciesSynthetic
- Promoter dl3 (Ef1a mutant)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SbfI (not destroyed)
- 5′ sequencing primer RVprimer3
- 3′ sequencing primer AGGTGCCCATCAGACTCACGTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDonorRMCE-For-dl3-mTagBFP2 was a gift from Joanna Wysocka (Addgene plasmid # 253436 ; http://n2t.net/addgene:253436 ; RRID:Addgene_253436) -
For your References section:
Promoter strength and position govern promoter competition through transcript-dependent insulation. Koska M, Nagano M, Swigut T, Boettiger AN, Hansen AS, Wysocka J. Nat Genet. 2026 Jul 20. doi: 10.1038/s41588-026-02691-y. 10.1038/s41588-026-02691-y PubMed 42477113